This HTML5 document contains 1124 embedded RDF statements represented using HTML+Microdata notation.

The embedded RDF content will be recognized by any processor of HTML5 Microdata.

Namespace Prefixes

PrefixIRI
rdfshttp://www.w3.org/2000/01/rdf-schema#
n10http://www.ncbi.nlm.nih.gov/pmc/articles/
bibohttp://purl.org/ontology/bibo/
dchttp://purl.org/dc/elements/1.1/
rdfhttp://www.w3.org/1999/02/22-rdf-syntax-ns#
n9http://pubannotation.org/docs/sourcedb/PMC/sourceid/
n8http://togows.dbcls.jp/entry/pubmed/
n5http://purl.jp/bio/10/colil/ontology/201303#
xsdhhttp://www.w3.org/2001/XMLSchema#
n2http://purl.jp/bio/10/colil/id/
n3http://purl.org/spar/doco/

Statements

Subject Item
n2:8976186
rdf:type
n5:RelevantPaper n5:ReferencePaper n5:CitationPaper
rdfs:seeAlso
n8:8976186 n9:0 n10:0
bibo:cites
n2:3317065 n2:8428934 n2:1698773 n2:1317321 n2:2167246 n2:1834568 n2:8052310 n2:1317291 n2:2471310 n2:6244318 n2:2825206 n2:1979752 n2:3486658 n2:2409450 n2:3041594 n2:2369899 n2:2447090 n2:2108318 n2:3030299 n2:2419900 n2:7685161 n2:6604729 n2:3306916 n2:7929245 n2:2104232 n2:7782289 n2:3401760 n2:2173721 n2:8132709 n2:2989045 n2:8170980 n2:2820711 n2:1323962 n2:2744464 n2:3148184 n2:2073318 n2:8382489 n2:2407272 n2:6307277 n2:2982822 n2:3005265 n2:2648958 n2:1730742 n2:7683678 n2:2551626 n2:2547836 n2:8156782 n2:1322694 n2:7308288 n2:3898078 n2:6891551 n2:1445287 n2:1109560 n2:2714213 n2:3576212 n2:1403008 n2:2071592 n2:8501514 n2:2515258 n2:2995374 n2:3595562 n2:7721824 n2:8435466 n2:2557356 n2:1512297 n2:3027580 n2:7930672 n2:8557686 n2:8283243 n2:3487091
n5:cocitationWith
n2:27630704 n2:18063113 n2:884520 n2:12127085 n2:19229995 n2:15191815 n2:18803324 n2:18803323 n2:14602826 n2:2825206 n2:18803315 n2:21455784 n2:30184491 n2:24098787 n2:10493747 n2:24434136 n2:16956757 n2:17562450 n2:19010442 n2:21865464 n2:18003835 n2:21401967 n2:16374766 n2:16787929 n2:21878126 n2:16405877 n2:22438979 n2:21490216 n2:1311314 n2:29323050 n2:17336456 n2:10366605 n2:1880536 n2:10924258 n2:2614485 n2:21175737 n2:8041754 n2:16962312 n2:16858390 n2:20448483 n2:12384502 n2:15691705 n2:15530839 n2:25506346 n2:17005848 n2:18814268 n2:11024548 n2:10650133 n2:2183684 n2:16297636 n2:27335572 n2:23895713 n2:8764655 n2:14657171 n2:11311801 n2:18413858 n2:11846609 n2:17185359 n2:16990514 n2:20547125 n2:11328886 n2:8182468 n2:20404842 n2:15686598 n2:15800203 n2:8786845 n2:10419448 n2:21666671 n2:17506644 n2:2271939 n2:16288297 n2:11943808 n2:20837483 n2:12106171 n2:19525946 n2:11567062 n2:19457117 n2:21368034 n2:3559478 n2:18264108 n2:18799670 n2:10442688 n2:17065436 n2:8649561 n2:9878200 n2:11202178 n2:4624688 n2:7830079 n2:20345246 n2:15044753 n2:12451140 n2:20097170 n2:17189680 n2:18298463 n2:8019679 n2:11433375 n2:8299723 n2:17341159 n2:12401344 n2:17099708 n2:26419777 n2:22985997 n2:12931315 n2:19321787 n2:11015722 n2:9030624 n2:23096265 n2:8664561 n2:14598318 n2:11687497 n2:16129398 n2:12196576 n2:10854648 n2:12151548 n2:16672230 n2:24991953 n2:17318226 n2:9651203 n2:11939349 n2:11939348 n2:8987819 n2:18817874 n2:15026117 n2:11168559 n2:20547838 n2:12112437 n2:7538855 n2:10408538 n2:176052 n2:18987193 n2:9334404 n2:26981078
n5:hasRelevantBibliographicResourceOf
_:vb205711568 _:vb205711569 _:vb205711552 _:vb205711553 _:vb205711554 _:vb205711555 _:vb205711556 _:vb205711557 _:vb205711558 _:vb205711559 _:vb205711560 _:vb205711561 _:vb205711562 _:vb205711563 _:vb205711564 _:vb205711565 _:vb205711566 _:vb205711567 _:vb205711536 _:vb205711537 _:vb205711538 _:vb205711539 _:vb205711540 _:vb205711541 _:vb205711542 _:vb205711543 _:vb205711544 _:vb205711545 _:vb205711546 _:vb205711547 _:vb205711548 _:vb205711549 _:vb205711550 _:vb205711551 _:vb205711520 _:vb205711521 _:vb205711522 _:vb205711523 _:vb205711524 _:vb205711525 _:vb205711526 _:vb205711527 _:vb205711528 _:vb205711529 _:vb205711530 _:vb205711531 _:vb205711532 _:vb205711533 _:vb205711534 _:vb205711535 _:vb205711504 _:vb205711505 _:vb205711506 _:vb205711507 _:vb205711508 _:vb205711509 _:vb205711510 _:vb205711511 _:vb205711512 _:vb205711513 _:vb205711514 _:vb205711515 _:vb205711516 _:vb205711517 _:vb205711518 _:vb205711519 _:vb205711488 _:vb205711489 _:vb205711490 _:vb205711491 _:vb205711492 _:vb205711493 _:vb205711494 _:vb205711495 _:vb205711496 _:vb205711497 _:vb205711498 _:vb205711499 _:vb205711500 _:vb205711501 _:vb205711502 _:vb205711503 _:vb205711472 _:vb205711473 _:vb205711474 _:vb205711475 _:vb205711476 _:vb205711477 _:vb205711478 _:vb205711479 _:vb205711480 _:vb205711481 _:vb205711482 _:vb205711483 _:vb205711484 _:vb205711485 _:vb205711486 _:vb205711487 _:vb205711456 _:vb205711457 _:vb205711458 _:vb205711459 _:vb205711460 _:vb205711461 _:vb205711462 _:vb205711463 _:vb205711464 _:vb205711465 _:vb205711466 _:vb205711467 _:vb205711468 _:vb205711469 _:vb205711470 _:vb205711471 _:vb205711440 _:vb205711441 _:vb205711442 _:vb205711443 _:vb205711444 _:vb205711445 _:vb205711446 _:vb205711447 _:vb205711448 _:vb205711449 _:vb205711450 _:vb205711451 _:vb205711452 _:vb205711453 _:vb205711454 _:vb205711455 _:vb205711438 _:vb205711439
n5:pmcid
PMC0
n3:contains
_:vb20228 _:vb20168 _:vb20191
Subject Item
_:vb20168
rdf:type
n3:Section
dc:title
materials and methods
n3:contains
_:vb20172 _:vb20173 _:vb20174 _:vb20175 _:vb20169 _:vb20170 _:vb20171 _:vb20180 _:vb20181 _:vb20182 _:vb20183 _:vb20176 _:vb20177 _:vb20178 _:vb20179 _:vb20188 _:vb20189 _:vb20190 _:vb20184 _:vb20185 _:vb20186 _:vb20187
Subject Item
_:vb20169
rdf:type
n5:Context
rdf:value
Macrophage-conditioned medium from lipopolysaccharide-stimulated (10 μg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (>>23<<) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect:
n5:mentions
n2:6604729
Subject Item
_:vb20170
rdf:type
n5:Context
rdf:value
lipopolysaccharide-stimulated (10 μg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-α (>>24<<), TGF-β1 (25), and IL-1α (7). Organ cultures were incubated for 12 h at 37°C in an atmosphere of 5% CO2.
n5:mentions
n2:3487091
Subject Item
_:vb20171
rdf:type
n5:Context
rdf:value
(10 μg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-α (24), TGF-β1 (>>25<<), and IL-1α (7). Organ cultures were incubated for 12 h at 37°C in an atmosphere of 5% CO2.
n5:mentions
n2:2820711
Subject Item
_:vb20172
rdf:type
n5:Context
rdf:value
(10 μg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-α (24), TGF-β1 (25), and IL-1α (>>7<<). Organ cultures were incubated for 12 h at 37°C in an atmosphere of 5% CO2.
n5:mentions
n2:3317065
Subject Item
_:vb20173
rdf:type
n5:Context
rdf:value
Nerve extracts were analyzed by gelatin zymography (>>26<<). Some samples were treated with 1 mM 4-aminophenylmercuric acetate (APMA) (Sigma Chemical Co., St.
n5:mentions
n2:3005265
Subject Item
_:vb20174
rdf:type
n5:Context
rdf:value
Louis, MO) for 1 h to partially activate MMPs, as described previously (>>27<<). Briefly, samples were solubilized in nonreducing Laemmli buffer without heating and separated on nonreducing 10% SDS– polyacrylamide gels containing 0.1% gelatin.
n5:mentions
n2:2744464
Subject Item
_:vb20175
rdf:type
n5:Context
rdf:value
To demonstrate metalloproteinase activity, the gel was incubated in substrate buffer with 50 μM 3-(Nhydroxycarbamoyl)-2(R)-isobutylpropionyl-l-tryptophan methylamide (GM6001) (>>28<<) (gift of R.
n5:mentions
n2:1322694
Subject Item
_:vb20176
rdf:type
n5:Context
rdf:value
Reverse zymography of TIMPs was carried out as described previously (>>26<<). Briefly, concentrated CM (equivalent to 250 μl for nerve samples and 300 μl for the calvaria control) was separated on nonreducing 13.5% SDS–polyacrylamide gels containing 0.1% gelatin and 25% (vol/vol) APMA-activated rabbit skin CM.
n5:mentions
n2:3005265
Subject Item
_:vb20177
rdf:type
n5:Context
rdf:value
Purified gelatinase B was prepared from the mouse macrophage cell line P388D1 and activated with APMA before use as described previously (>>29<<). Gelatin-degrading activity in nerve extracts was determined by using heat-denatured 14C-labeled collagen type I (boiled for 5 min; provided by M.J. Banda, University of California, San Francisco, CA) as a substrate (30). Various amounts
n5:mentions
n2:1317291
Subject Item
_:vb20178
rdf:type
n5:Context
rdf:value
Gelatin-degrading activity in nerve extracts was determined by using heat-denatured 14C-labeled collagen type I (boiled for 5 min; provided by M.J. Banda, University of California, San Francisco, CA) as a substrate (>>30<<). Various amounts of nerve extract or recombinant human TIMP-1 (0–30 ng) (gift of D. Carmichael, Synergen, Boulder, CO) were preincubated at 37°C for 1 h in the presence of 100 ng purified gelatinase B in a volume of 150 μl, and then 50
n5:mentions
n2:6307277
Subject Item
_:vb20179
rdf:type
n5:Context
rdf:value
The K i of TIMP-1 inhibition of gelatinase B activity in this assay, determined by titration of gelatinase B with various amounts of recombinant TIMP-1, was 0.1 nM, which corresponds to previous findings (>>30<<).
n5:mentions
n2:6307277
Subject Item
_:vb20180
rdf:type
n5:Context
rdf:value
This assay was performed essentially as described previously (>>32<<). Briefly, to assess laminin and type IV collagen (COL IV) degradation in vitro, we placed 10-μm cryosections of uninjured sciatic nerve on sterile, precoated (0.1% gelatin) glass coverslips.
n5:mentions
n2:7929245
Subject Item
_:vb20181
rdf:type
n5:Context
rdf:value
Primers used in PCR reactions for apolipoprotein E (ApoE), CSF-1, glyceraldehyde-6-phosphate dehydrogenase (GAPDH), TNF-α, TGF-β1, stromelysin-1, TIMP-1, IL-1α and NGF-β were described previously (>>33<<–35). The following oligonucleotides were synthesized on a PCR Mate (Applied Biosystems Inc., Foster City, CA) and used for PCR:
n5:mentions
n2:1317321 n2:2407272 n2:3041594
Subject Item
_:vb20182
rdf:type
n5:Context
rdf:value
were synthesized on a PCR Mate (Applied Biosystems Inc., Foster City, CA) and used for PCR: c-fms (36) 5′-primer: AAGAACATATACAGCATCATGCAG (bp 2713–2737), 3′-primer: CGATGTCCCCTGGCTCACAGCA (bp 2945–2966); p75 low-affinity NGF receptor (>>37<<) 5′-primer: CAGAGCCTGCACGACCAGCAGACCCA (bp 1050–1075), 3′-primer: GGCCAGCAGGGCTCGCACTGGGCA (bp 1247–1269); gelatinase B (38) 5′-primer:
n5:mentions
n2:3027580
Subject Item
_:vb20183
rdf:type
n5:Context
rdf:value
(bp 2713–2737), 3′-primer: CGATGTCCCCTGGCTCACAGCA (bp 2945–2966); p75 low-affinity NGF receptor (37) 5′-primer: CAGAGCCTGCACGACCAGCAGACCCA (bp 1050–1075), 3′-primer: GGCCAGCAGGGCTCGCACTGGGCA (bp 1247–1269); gelatinase B (>>38<<) 5′-primer: CGCTCATGTACCCGCTGTATAGCTAC (bp 1277–1302), 3′-primer: TAGAGGCCTCAGAAGAGCCCGCA (bp 1575–1597).
n5:mentions
n2:8382489
Subject Item
_:vb20184
rdf:type
n5:Context
rdf:value
Based on these values, the cDNA in each unlabeled RT mix was equalized by dilution in water. Semi-quantitative PCR was performed as described previously (>>40<<). Briefly, the cDNA was amplified in the thermocycler (Gene Amp PCR thermocycler; Perkin-Elmer Corp., Norwalk, CT) in a final volume of 30 μl containing 50 mM KCl, 10 mM Tris, pH 8.3, 4 mM MgCl2, 0.4 μM 5′ and 3′ primers, and 0.6 U of Taq
n5:mentions
n2:1979752
Subject Item
_:vb20185
rdf:type
n5:Context
rdf:value
The following random-primed cDNA probes were used: mouse TIMP-1 full-length cDNA (>>41<<) and a partiallength mouse gelatinase B.
n5:mentions
n2:2447090
Subject Item
_:vb20186
rdf:type
n5:Context
rdf:value
The gelatinase B probe was synthesized with RNA from 1-d postcrush nerve by RT-PCR using the conditions described previously (>>38<<), subcloned into pBluescript KS, and sequenced.
n5:mentions
n2:8382489
Subject Item
_:vb20187
rdf:type
n5:Context
rdf:value
For antibody staining, serial cryosections were rehydrated, blocked in 5% normal serum, and incubated for 1 h at 25°C with either macrophage-specific rat mAb F4/80 (>>42<<) (1:5; gift of S. Gordon, University of Oxford, Oxford, England) or polyclonal rabbit anti–bovine antibody S-100 (1:2,000; Dako Corp., Carpenteria, CA). Biotinylated secondary antibody, the avidin-biotin-peroxidase complex, and the
n5:mentions
n2:7308288
Subject Item
_:vb20188
rdf:type
n5:Context
rdf:value
Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (>>41<<); a 920-bp (position 709–1629) fragment of mouse TNF-α cDNA (43); or a 294-bp (position 805– 1099) fragment of mouse gelatinase B (44) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions
n5:mentions
n2:2447090
Subject Item
_:vb20189
rdf:type
n5:Context
rdf:value
Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (41); a 920-bp (position 709–1629) fragment of mouse TNF-α cDNA (>>43<<); or a 294-bp (position 805– 1099) fragment of mouse gelatinase B (44) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions (Boehringer Mannheim Corp., Indianapolis, IN).
n5:mentions
n2:3898078
Subject Item
_:vb20190
rdf:type
n5:Context
rdf:value
Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (41); a 920-bp (position 709–1629) fragment of mouse TNF-α cDNA (43); or a 294-bp (position 805– 1099) fragment of mouse gelatinase B (>>44<<) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions (Boehringer Mannheim Corp., Indianapolis, IN).
n5:mentions
n2:8132709
Subject Item
_:vb20191
rdf:type
n3:Section
dc:title
results
n3:contains
_:vb20224 _:vb20225 _:vb20226 _:vb20227 _:vb20216 _:vb20217 _:vb20218 _:vb20219 _:vb20220 _:vb20221 _:vb20222 _:vb20223 _:vb20208 _:vb20209 _:vb20210 _:vb20211 _:vb20212 _:vb20213 _:vb20214 _:vb20215 _:vb20200 _:vb20201 _:vb20202 _:vb20203 _:vb20204 _:vb20205 _:vb20206 _:vb20207 _:vb20192 _:vb20193 _:vb20194 _:vb20195 _:vb20196 _:vb20197 _:vb20198 _:vb20199
Subject Item
_:vb20192
rdf:type
n5:Context
rdf:value
The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (>>10<<) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18).
n5:mentions
n2:2471310
Subject Item
_:vb20193
rdf:type
n5:Context
rdf:value
The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (>>20<<, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18).
n5:mentions
n2:2369899
Subject Item
_:vb20194
rdf:type
n5:Context
rdf:value
The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, >>45<<, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18).
n5:mentions
n2:6891551
Subject Item
_:vb20195
rdf:type
n5:Context
rdf:value
The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, >>46<<), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18).
n5:mentions
n2:3148184
Subject Item
_:vb20196
rdf:type
n5:Context
rdf:value
proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (>>9<<, 18). MMPs, however, are the major contributors to ECM degradation. Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (6, 8).
n5:mentions
n2:2989045
Subject Item
_:vb20197
rdf:type
n5:Context
rdf:value
proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, >>18<<). MMPs, however, are the major contributors to ECM degradation. Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (6, 8).
n5:mentions
n2:2714213
Subject Item
_:vb20198
rdf:type
n5:Context
rdf:value
Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (>>6<<, 8). Tissue extracts from sham-operated nerve, contralateral nerve, and the proximal-crush-distal segments of injured nerve showed gelatinolytic bands migrating at 92, 85, 72, and 66 kD, corresponding to progelatinase B, active gelatinase
n5:mentions
n2:1323962
Subject Item
_:vb20199
rdf:type
n5:Context
rdf:value
The gelatinolytic bands migrating at 135 kD are likely to be complexes formed between gelatinase B and neutrophil gelatinase-associated lipocalin (NGAL) (>>47<<), and bands at >135 kD are probably aggregates of gelatinase B (48).
n5:mentions
n2:7683678
Subject Item
_:vb20200
rdf:type
n5:Context
rdf:value
The gelatinolytic bands migrating at 135 kD are likely to be complexes formed between gelatinase B and neutrophil gelatinase-associated lipocalin (NGAL) (47), and bands at >135 kD are probably aggregates of gelatinase B (>>48<<).
n5:mentions
n2:2982822
Subject Item
_:vb20201
rdf:type
n5:Context
rdf:value
In the crush and distal segments, gelatinolytic bands 92 and 72 kD shifted to lower molecular weight species of 85 and 66 kD, respectively, after APMA treatment, indicating latency (>>27<<). Because of partial activation by APMA treatment, other gelatinolytic bands generated represent intermediate forms of the proenzyme. Incubation of the zymogram with the synthetic MMP inhibitor GM6001 identified all the gelatinases as
n5:mentions
n2:2744464
Subject Item
_:vb20202
rdf:type
n5:Context
rdf:value
To determine whether stromelysin-1, which has been found in cultures of NGFstimulated PC12 cells and mitogen-stimulated Schwann cells (>>49<<), was present in crushed nerve, we analyzed samples of medium conditioned by segments of crushed or contralateral nerve by immunoblotting (Fig.
n5:mentions
n2:1730742
Subject Item
_:vb20203
rdf:type
n5:Context
rdf:value
A small amount of active stromelysin-1 migrating at 45 kD was visualized in concentrated CM from crush and distal segments, but not with contralateral nerve. The lower band at 35 kD is another cleavage product of stromelysin-1 (>>50<<).
n5:mentions
n2:2995374
Subject Item
_:vb20204
rdf:type
n5:Context
rdf:value
With a sensitive enzymatic assay based on inhibition of 14C-labeled gelatin degradation by purified gelatinase B (>>30<<, 51), we found that extracts of injured nerve contained net MMP inhibitory activity (Fig.
n5:mentions
n2:6307277
Subject Item
_:vb20205
rdf:type
n5:Context
rdf:value
With a sensitive enzymatic assay based on inhibition of 14C-labeled gelatin degradation by purified gelatinase B (30, >>51<<), we found that extracts of injured nerve contained net MMP inhibitory activity (Fig.
n5:mentions
n2:2071592
Subject Item
_:vb20206
rdf:type
n5:Context
rdf:value
activity present in 4-d postcrush nerve extracts was equivalent to 2 ng recombinant TIMP-1/5 μg extractable protein and was comparable to the inhibitory activity found in extracts of calvaria, which has high levels of TIMP-1 activity (>>52<<). No inhibitory activity was found in extracts of contralateral nerve.
n5:mentions
n2:2547836
Subject Item
_:vb20207
rdf:type
n5:Context
rdf:value
The major inhibitory band at 28 kD secreted by the crushed nerve segments comigrated with TIMP-1 (>>30<<) from the mouse calvarial CM standard and was increased as compared with contralateral nerve.
n5:mentions
n2:6307277
Subject Item
_:vb20208
rdf:type
n5:Context
rdf:value
Small amounts of inhibitor migrating at 22 kD, which were present in CM from injured nerve but undetectable in CM from contralateral nerve, comigrated with TIMP-2 (>>26<<). The inhibitory band at 24 kD migrated like TIMP-3 (53).
n5:mentions
n2:3005265
Subject Item
_:vb20209
rdf:type
n5:Context
rdf:value
Small amounts of inhibitor migrating at 22 kD, which were present in CM from injured nerve but undetectable in CM from contralateral nerve, comigrated with TIMP-2 (26). The inhibitory band at 24 kD migrated like TIMP-3 (>>53<<).
n5:mentions
n2:7782289
Subject Item
_:vb20210
rdf:type
n5:Context
rdf:value
After injury to nerve, Schwann cell BM remains intact and serves as a substrate to guide and stimulate axonal regrowth (>>4<<, 17). Because we observed an increase in both TIMP-1 and MMP activities in injured nerve, we concluded that TIMP-1 may regulate MMP activity in the nerve after injury.
n5:mentions
n2:2648958
Subject Item
_:vb20211
rdf:type
n5:Context
rdf:value
After injury to nerve, Schwann cell BM remains intact and serves as a substrate to guide and stimulate axonal regrowth (4, >>17<<). Because we observed an increase in both TIMP-1 and MMP activities in injured nerve, we concluded that TIMP-1 may regulate MMP activity in the nerve after injury.
n5:mentions
n2:2551626
Subject Item
_:vb20212
rdf:type
n5:Context
rdf:value
This marker was therefore useful for normalizing the levels of mRNA despite a 5–10-fold increase in cell number (>>55<<, 56) and a corresponding increase in total RNA due to Schwann cell proliferation and macrophage influx.
n5:mentions
n2:6244318
Subject Item
_:vb20213
rdf:type
n5:Context
rdf:value
This marker was therefore useful for normalizing the levels of mRNA despite a 5–10-fold increase in cell number (55, >>56<<) and a corresponding increase in total RNA due to Schwann cell proliferation and macrophage influx.
n5:mentions
n2:3401760
Subject Item
_:vb20214
rdf:type
n5:Context
rdf:value
ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (>>57<<, 58), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (59), were used as markers for macrophages.
n5:mentions
n2:2419900
Subject Item
_:vb20215
rdf:type
n5:Context
rdf:value
ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (57, >>58<<), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (59), were used as markers for macrophages.
n5:mentions
n2:3576212
Subject Item
_:vb20216
rdf:type
n5:Context
rdf:value
ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (57, 58), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (>>59<<), were used as markers for macrophages.
n5:mentions
n2:2409450
Subject Item
_:vb20217
rdf:type
n5:Context
rdf:value
The expression of mRNA for NGF-β, a trophic factor critical for neuronal survival and growth (>>60<<), was upregulated after injury (Fig.
n5:mentions
n2:3306916
Subject Item
_:vb20218
rdf:type
n5:Context
rdf:value
At day 1, before the influx of macrophages, mast cells may produce NGF-β mRNA (>>61<<), whereas Schwann cells stimulated by macrophage-derived IL-1α (7) may express NGF-β at day 4.
n5:mentions
n2:8170980
Subject Item
_:vb20219
rdf:type
n5:Context
rdf:value
At day 1, before the influx of macrophages, mast cells may produce NGF-β mRNA (61), whereas Schwann cells stimulated by macrophage-derived IL-1α (>>7<<) may express NGF-β at day 4.
n5:mentions
n2:3317065
Subject Item
_:vb20220
rdf:type
n5:Context
rdf:value
F4/80 positive cells were numerous in the crush segment, some displaying a rounded morphology and others arranged in strings of rounded cells called foamy macrophages (>>62<<). These may represent either infiltrating or resident macrophages. In the distal segment, macrophages were mostly rounded or ramified, whereas the few resident macrophages present in the proximal segment had extensive ramified cytoplasmic
n5:mentions
n2:1403008
Subject Item
_:vb20221
rdf:type
n5:Context
rdf:value
Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-β1, TNF-α, and IL-1α (>>34<<), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, 63, 64).
n5:mentions
n2:1317321
Subject Item
_:vb20222
rdf:type
n5:Context
rdf:value
Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-β1, TNF-α, and IL-1α (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (>>25<<, 63, 64). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium
n5:mentions
n2:2820711
Subject Item
_:vb20223
rdf:type
n5:Context
rdf:value
Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-β1, TNF-α, and IL-1α (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, >>63<<, 64). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium
n5:mentions
n2:2167246
Subject Item
_:vb20224
rdf:type
n5:Context
rdf:value
Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-β1, TNF-α, and IL-1α (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, 63, >>64<<). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium conditioned by
n5:mentions
n2:1698773
Subject Item
_:vb20225
rdf:type
n5:Context
rdf:value
TGF-β1 and TNF-α were clearly autoinductive for their own mRNAs, in agreement with previous reports (>>65<<, 66). GAPDH mRNA was unaltered by these treatments. NGF-β mRNA expression increased from three- to fivefold in the presence of TNF-α and TGF-β1 and up to 11-fold in the presence of IL-1α, thus confirming previous results (7). These data
n5:mentions
n2:2108318
Subject Item
_:vb20226
rdf:type
n5:Context
rdf:value
TGF-β1 and TNF-α were clearly autoinductive for their own mRNAs, in agreement with previous reports (65, >>66<<). GAPDH mRNA was unaltered by these treatments. NGF-β mRNA expression increased from three- to fivefold in the presence of TNF-α and TGF-β1 and up to 11-fold in the presence of IL-1α, thus confirming previous results (7). These data
n5:mentions
n2:2104232
Subject Item
_:vb20227
rdf:type
n5:Context
rdf:value
NGF-β mRNA expression increased from three- to fivefold in the presence of TNF-α and TGF-β1 and up to 11-fold in the presence of IL-1α, thus confirming previous results (>>7<<). These data suggest a macrophage/cytokine regulatory circuit that could be responsible for controlling TIMP-1 gene expression and thus BM remodeling in peripheral nerve after injury.
n5:mentions
n2:3317065
Subject Item
_:vb20228
rdf:type
n3:Section
dc:title
discussion
n3:contains
_:vb20260 _:vb20261 _:vb20262 _:vb20263 _:vb20256 _:vb20257 _:vb20258 _:vb20259 _:vb20264 _:vb20244 _:vb20245 _:vb20246 _:vb20247 _:vb20240 _:vb20241 _:vb20242 _:vb20243 _:vb20252 _:vb20253 _:vb20254 _:vb20255 _:vb20248 _:vb20249 _:vb20250 _:vb20251 _:vb20229 _:vb20230 _:vb20231 _:vb20236 _:vb20237 _:vb20238 _:vb20239 _:vb20232 _:vb20233 _:vb20234 _:vb20235
Subject Item
_:vb20229
rdf:type
n5:Context
rdf:value
ECM-degrading proteinases and their inhibitors play an active role in BM turnover during remodeling and repair after injury (>>21<<, 22). Previous studies have shown the importance of proteinases and their inhibitors in the regenerative phase after nerve injury in vivo, but have not addressed how BM can be preserved in such a proteolytic environment and how it can
n5:mentions
n2:1445287
Subject Item
_:vb20230
rdf:type
n5:Context
rdf:value
ECM-degrading proteinases and their inhibitors play an active role in BM turnover during remodeling and repair after injury (21, >>22<<). Previous studies have shown the importance of proteinases and their inhibitors in the regenerative phase after nerve injury in vivo, but have not addressed how BM can be preserved in such a proteolytic environment and how it can support
n5:mentions
n2:8435466
Subject Item
_:vb20231
rdf:type
n5:Context
rdf:value
Both cell types are known to release gelatinase B after stimulation in vitro (>>48<<, 67). Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (11). This result is borne
n5:mentions
n2:2982822
Subject Item
_:vb20232
rdf:type
n5:Context
rdf:value
Both cell types are known to release gelatinase B after stimulation in vitro (48, >>67<<). Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (11). This result is borne out
n5:mentions
n2:2173721
Subject Item
_:vb20233
rdf:type
n5:Context
rdf:value
Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (>>11<<). This result is borne out by our in situ hybridization analysis showing increased gelatinase B mRNA expression in both macrophages and Schwann cells in the crush and distal segments of sciatic nerve at 4 d after crush, before axonal
n5:mentions
n2:1834568
Subject Item
_:vb20234
rdf:type
n5:Context
rdf:value
Schwann cells are the likely source of stromelysin-1 in nerve injury because they produce this MMP in vitro (>>49<<).
n5:mentions
n2:1730742
Subject Item
_:vb20235
rdf:type
n5:Context
rdf:value
In keratoconus corneal injury (>>68<<) and in cutaneous burn wounds (69), proteinases are in excess of inhibitors, and net ECM degradation does occur.
n5:mentions
n2:8156782
Subject Item
_:vb20236
rdf:type
n5:Context
rdf:value
In keratoconus corneal injury (68) and in cutaneous burn wounds (>>69<<), proteinases are in excess of inhibitors, and net ECM degradation does occur.
n5:mentions
n2:7930672
Subject Item
_:vb20237
rdf:type
n5:Context
rdf:value
Stromelysin-1, a proteinase that degrades the other BM components, fibronectin and proteoglycans (>>50<<, 54), was also upregulated after injury and is known to be inhibited by TIMP-1 in vivo and in vitro (70).
n5:mentions
n2:2995374
Subject Item
_:vb20238
rdf:type
n5:Context
rdf:value
Stromelysin-1, a proteinase that degrades the other BM components, fibronectin and proteoglycans (50, 54), was also upregulated after injury and is known to be inhibited by TIMP-1 in vivo and in vitro (>>70<<). Interestingly, we and others (71) have observed that immunoreactive laminin and COL IV were maintained in vivo for up to 4 wk after axotomy and for 10 d after crush. Our data indicate that one important role for TIMP-1 in vivo is the
n5:mentions
n2:1512297
Subject Item
_:vb20239
rdf:type
n5:Context
rdf:value
Interestingly, we and others (>>71<<) have observed that immunoreactive laminin and COL IV were maintained in vivo for up to 4 wk after axotomy and for 10 d after crush.
n5:mentions
n2:2515258
Subject Item
_:vb20240
rdf:type
n5:Context
rdf:value
Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (>>22<<, 25, 72, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-β1 and TNF-α during early and late phases.
n5:mentions
n2:8435466
Subject Item
_:vb20241
rdf:type
n5:Context
rdf:value
Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, >>25<<, 72, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-β1 and TNF-α during early and late phases.
n5:mentions
n2:2820711
Subject Item
_:vb20242
rdf:type
n5:Context
rdf:value
Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, 25, >>72<<, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-β1 and TNF-α during early and late phases.
n5:mentions
n2:3030299
Subject Item
_:vb20243
rdf:type
n5:Context
rdf:value
Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, 25, 72, >>73<<). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-β1 and TNF-α during early and late phases.
n5:mentions
n2:8557686
Subject Item
_:vb20244
rdf:type
n5:Context
rdf:value
Although we did not identify which cells synthesized TGF-β1 and TNF-α in the early phase after injury, these cytokines may be produced by resident macrophages, Schwann cells, or mast cells in injured peripheral nerve (8, >>61<<, 74). In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, 59). This increase occurred within 1 d of crush injury, before the influx
n5:mentions
n2:8170980
Subject Item
_:vb20245
rdf:type
n5:Context
rdf:value
Although we did not identify which cells synthesized TGF-β1 and TNF-α in the early phase after injury, these cytokines may be produced by resident macrophages, Schwann cells, or mast cells in injured peripheral nerve (8, 61, >>74<<). In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, 59). This increase occurred within 1 d of crush injury, before the influx of
n5:mentions
n2:2073318
Subject Item
_:vb20246
rdf:type
n5:Context
rdf:value
In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (>>6<<, 59). This increase occurred within 1 d of crush injury, before the influx of inflammatory macrophages. That TNF-α and TGF-β1 may initiate and regulate TIMP-1 expression during the early and late phases of nerve regeneration is supported
n5:mentions
n2:1323962
Subject Item
_:vb20247
rdf:type
n5:Context
rdf:value
In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, >>59<<). This increase occurred within 1 d of crush injury, before the influx of inflammatory macrophages. That TNF-α and TGF-β1 may initiate and regulate TIMP-1 expression during the early and late phases of nerve regeneration is supported by
n5:mentions
n2:2409450
Subject Item
_:vb20248
rdf:type
n5:Context
rdf:value
NGF-β mRNA also displays a biphasic induction in the crush and distal segments after injury (>>75<<). As may be the case for TNF-α, activated mast cells which interact closely with innervating fibers in vivo and are known to release NGF-β (61), may be responsible for the first increase in NGF-β mRNA, whereas the second increase is
n5:mentions
n2:2825206
Subject Item
_:vb20249
rdf:type
n5:Context
rdf:value
As may be the case for TNF-α, activated mast cells which interact closely with innervating fibers in vivo and are known to release NGF-β (>>61<<), may be responsible for the first increase in NGF-β mRNA, whereas the second increase is mediated by macrophage-derived IL-1 (75).
n5:mentions
n2:8170980
Subject Item
_:vb20250
rdf:type
n5:Context
rdf:value
mast cells which interact closely with innervating fibers in vivo and are known to release NGF-β (61), may be responsible for the first increase in NGF-β mRNA, whereas the second increase is mediated by macrophage-derived IL-1 (>>75<<). NGF-β expression has been localized to Schwann cells and fibroblasts in sciatic nerve (76).
n5:mentions
n2:2825206
Subject Item
_:vb20251
rdf:type
n5:Context
rdf:value
NGF-β expression has been localized to Schwann cells and fibroblasts in sciatic nerve (>>76<<). Interestingly, we observed the induction of NGF-β in parallel with a small increase in TNF-α. TNF-α induces NGF-β in fibroblasts (77) and may regulate levels of NGF-β in a similar way in Schwann cells and endoneurial fibroblasts of
n5:mentions
n2:3595562
Subject Item
_:vb20252
rdf:type
n5:Context
rdf:value
TNF-α induces NGF-β in fibroblasts (>>77<<) and may regulate levels of NGF-β in a similar way in Schwann cells and endoneurial fibroblasts of regenerating nerve.
n5:mentions
n2:8428934
Subject Item
_:vb20253
rdf:type
n5:Context
rdf:value
In the distal segment, NGF-β expression increased 4 d after injury, then fell markedly at the onset of regeneration at day 7, as shown previously (>>75<<). We observed upregulation of stromelysin-1 in parallel with the induction of NGF-β. Interestingly, NGF-β stimulates the transcription of stromelysin-1 mRNA in PC12 cells through a NGF-responsive element in the promoter region of the
n5:mentions
n2:2825206
Subject Item
_:vb20254
rdf:type
n5:Context
rdf:value
Interestingly, NGF-β stimulates the transcription of stromelysin-1 mRNA in PC12 cells through a NGF-responsive element in the promoter region of the stromelysin-1 gene (>>78<<). A similar process may modulate stromelysin-1 expression during degeneration.
n5:mentions
n2:7721824
Subject Item
_:vb20255
rdf:type
n5:Context
rdf:value
Leibovich and Ross (>>79<<) demonstrated that ablation of macrophages impairs the progression of dermal wound healing.
n5:mentions
n2:1109560
Subject Item
_:vb20256
rdf:type
n5:Context
rdf:value
In peripheral nerves, regeneration and degeneration do not occur without an influx of inflammatory macrophages (>>6<<). During Wallerian degeneration, macrophages play a key role in myelin removal in the later phases of repair. Schwann cells have been shown to initiate myelin degradation in vivo before the influx of macrophages, whereas infiltrating
n5:mentions
n2:1323962
Subject Item
_:vb20257
rdf:type
n5:Context
rdf:value
Schwann cells have been shown to initiate myelin degradation in vivo before the influx of macrophages, whereas infiltrating macrophages degrade the bulk of myelin during later stages of repair (>>80<<). Macrophages also produce an array of growth factors and cytokines after nerve injury. Up until now, our knowledge of the pleiotropic effects of these factors after nerve injury was limited. It is possible, based on results from in vitro
n5:mentions
n2:8283243
Subject Item
_:vb20258
rdf:type
n5:Context
rdf:value
It is possible, based on results from in vitro experiments, that TGF-β1 may trigger Schwann proliferation in vivo (>>81<<), whereas TNF-α may regulate levels of IL-1 (82) which in turn may stimulate the induction of NGF-β in Schwann cells (7).
n5:mentions
n2:2557356
Subject Item
_:vb20259
rdf:type
n5:Context
rdf:value
It is possible, based on results from in vitro experiments, that TGF-β1 may trigger Schwann proliferation in vivo (81), whereas TNF-α may regulate levels of IL-1 (>>82<<) which in turn may stimulate the induction of NGF-β in Schwann cells (7).
n5:mentions
n2:3486658
Subject Item
_:vb20260
rdf:type
n5:Context
rdf:value
It is possible, based on results from in vitro experiments, that TGF-β1 may trigger Schwann proliferation in vivo (81), whereas TNF-α may regulate levels of IL-1 (82) which in turn may stimulate the induction of NGF-β in Schwann cells (>>7<<). Our results show that these macrophage-derived cytokines not only regulate cytokine and growth factor mRNA expression in nerve, but also may regulate TIMP-1 and MMP expression.
n5:mentions
n2:3317065
Subject Item
_:vb20261
rdf:type
n5:Context
rdf:value
Gelatinase B can degrade myelin basic protein (>>83<<). Increased proteolytic activity in both macrophages and Schwann cells may enhance myelin degradation during the degenerative phase, or may be required to free Schwann cells from their BM connections as they proliferate and reestablish
n5:mentions
n2:7685161
Subject Item
_:vb20262
rdf:type
n5:Context
rdf:value
Proteases have also been implicated in the truncation and inactivation of p75 lowaffinity NGF receptor (>>85<<), and in the processing of TNF-α precursor to its secreted form in vitro (86).
n5:mentions
n2:8501514
Subject Item
_:vb20263
rdf:type
n5:Context
rdf:value
Proteases have also been implicated in the truncation and inactivation of p75 lowaffinity NGF receptor (85), and in the processing of TNF-α precursor to its secreted form in vitro (>>86<<). Additionally, a Schwann cell–derived proteinase, possibly stromelysin-1, cleaves fibronectin to generate a proteolytic fragment with anti-proliferative activity on Schwann cells in culture (49). It is clear from these findings that MMP
n5:mentions
n2:8052310
Subject Item
_:vb20264
rdf:type
n5:Context
rdf:value
Additionally, a Schwann cell–derived proteinase, possibly stromelysin-1, cleaves fibronectin to generate a proteolytic fragment with anti-proliferative activity on Schwann cells in culture (>>49<<). It is clear from these findings that MMP activities are not limited to BM and myelin degradation and may be involved in many other processes.
n5:mentions
n2:1730742
Subject Item
_:vb205711438
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
6
n5:hasRelevantPaperId
n2:16405877
Subject Item
_:vb205711439
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
6
n5:hasRelevantPaperId
n2:18817874
Subject Item
_:vb205711440
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
6
n5:hasRelevantPaperId
n2:17189680
Subject Item
_:vb205711441
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
6
n5:hasRelevantPaperId
n2:18987193
Subject Item
_:vb205711442
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
5
n5:hasRelevantPaperId
n2:17318226
Subject Item
_:vb205711443
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
5
n5:hasRelevantPaperId
n2:17005848
Subject Item
_:vb205711444
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
5
n5:hasRelevantPaperId
n2:16297636
Subject Item
_:vb205711445
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:18264108
Subject Item
_:vb205711446
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:10650133
Subject Item
_:vb205711447
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:12451140
Subject Item
_:vb205711448
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:18803323
Subject Item
_:vb205711449
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:11202178
Subject Item
_:vb205711450
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:12127085
Subject Item
_:vb205711451
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:14598318
Subject Item
_:vb205711452
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:11943808
Subject Item
_:vb205711453
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
4
n5:hasRelevantPaperId
n2:12151548
Subject Item
_:vb205711454
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:2614485
Subject Item
_:vb205711455
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:12112437
Subject Item
_:vb205711456
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:11687497
Subject Item
_:vb205711457
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:12384502
Subject Item
_:vb205711458
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:11433375
Subject Item
_:vb205711459
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:18814268
Subject Item
_:vb205711460
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:16990514
Subject Item
_:vb205711461
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:21865464
Subject Item
_:vb205711462
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:10924258
Subject Item
_:vb205711463
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:9651203
Subject Item
_:vb205711464
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:20448483
Subject Item
_:vb205711465
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:884520
Subject Item
_:vb205711466
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:22438979
Subject Item
_:vb205711467
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:11939348
Subject Item
_:vb205711468
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:2825206
Subject Item
_:vb205711469
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:15800203
Subject Item
_:vb205711470
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:17099708
Subject Item
_:vb205711471
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:19229995
Subject Item
_:vb205711472
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
3
n5:hasRelevantPaperId
n2:7538855
Subject Item
_:vb205711473
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:12106171
Subject Item
_:vb205711474
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:12196576
Subject Item
_:vb205711475
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15026117
Subject Item
_:vb205711476
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20404842
Subject Item
_:vb205711477
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:4624688
Subject Item
_:vb205711478
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10419448
Subject Item
_:vb205711479
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:2271939
Subject Item
_:vb205711480
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11015722
Subject Item
_:vb205711481
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15686598
Subject Item
_:vb205711482
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:19010442
Subject Item
_:vb205711483
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21368034
Subject Item
_:vb205711484
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8649561
Subject Item
_:vb205711485
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10442688
Subject Item
_:vb205711486
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18003835
Subject Item
_:vb205711487
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20547125
Subject Item
_:vb205711488
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:25506346
Subject Item
_:vb205711489
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:176052
Subject Item
_:vb205711490
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8764655
Subject Item
_:vb205711491
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11168559
Subject Item
_:vb205711492
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16787929
Subject Item
_:vb205711493
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:24991953
Subject Item
_:vb205711494
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11024548
Subject Item
_:vb205711495
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18298463
Subject Item
_:vb205711496
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15530839
Subject Item
_:vb205711497
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20097170
Subject Item
_:vb205711498
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20547838
Subject Item
_:vb205711499
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:26419777
Subject Item
_:vb205711500
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:1880536
Subject Item
_:vb205711501
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18803324
Subject Item
_:vb205711502
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10366605
Subject Item
_:vb205711503
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10854648
Subject Item
_:vb205711504
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16288297
Subject Item
_:vb205711505
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:27335572
Subject Item
_:vb205711506
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:19457117
Subject Item
_:vb205711507
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8786845
Subject Item
_:vb205711508
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:19321787
Subject Item
_:vb205711509
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21401967
Subject Item
_:vb205711510
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:9878200
Subject Item
_:vb205711511
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17065436
Subject Item
_:vb205711512
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17336456
Subject Item
_:vb205711513
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11846609
Subject Item
_:vb205711514
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16858390
Subject Item
_:vb205711515
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17506644
Subject Item
_:vb205711516
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:7830079
Subject Item
_:vb205711517
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15044753
Subject Item
_:vb205711518
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15691705
Subject Item
_:vb205711519
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17562450
Subject Item
_:vb205711520
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8664561
Subject Item
_:vb205711521
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8987819
Subject Item
_:vb205711522
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:12401344
Subject Item
_:vb205711523
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16129398
Subject Item
_:vb205711524
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18063113
Subject Item
_:vb205711525
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18413858
Subject Item
_:vb205711526
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8182468
Subject Item
_:vb205711527
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17185359
Subject Item
_:vb205711528
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20345246
Subject Item
_:vb205711529
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21666671
Subject Item
_:vb205711530
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:23096265
Subject Item
_:vb205711531
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:3559478
Subject Item
_:vb205711532
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11311801
Subject Item
_:vb205711533
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:14657171
Subject Item
_:vb205711534
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21878126
Subject Item
_:vb205711535
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:23895713
Subject Item
_:vb205711536
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10493747
Subject Item
_:vb205711537
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16374766
Subject Item
_:vb205711538
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16672230
Subject Item
_:vb205711539
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:17341159
Subject Item
_:vb205711540
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18799670
Subject Item
_:vb205711541
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:22985997
Subject Item
_:vb205711542
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8299723
Subject Item
_:vb205711543
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:9334404
Subject Item
_:vb205711544
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11939349
Subject Item
_:vb205711545
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8019679
Subject Item
_:vb205711546
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:9030624
Subject Item
_:vb205711547
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:29323050
Subject Item
_:vb205711548
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:10408538
Subject Item
_:vb205711549
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11567062
Subject Item
_:vb205711550
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21455784
Subject Item
_:vb205711551
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:8041754
Subject Item
_:vb205711552
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:15191815
Subject Item
_:vb205711553
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:19525946
Subject Item
_:vb205711554
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:24098787
Subject Item
_:vb205711555
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:2183684
Subject Item
_:vb205711556
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:14602826
Subject Item
_:vb205711557
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16956757
Subject Item
_:vb205711558
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:26981078
Subject Item
_:vb205711559
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:27630704
Subject Item
_:vb205711560
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:18803315
Subject Item
_:vb205711561
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21175737
Subject Item
_:vb205711562
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:1311314
Subject Item
_:vb205711563
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:16962312
Subject Item
_:vb205711564
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:20837483
Subject Item
_:vb205711565
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:24434136
Subject Item
_:vb205711566
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:11328886
Subject Item
_:vb205711567
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:12931315
Subject Item
_:vb205711568
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:21490216
Subject Item
_:vb205711569
rdf:type
n5:RelevantBibliographicResource
n5:RelevantScore
2
n5:hasRelevantPaperId
n2:30184491