_:b20199 "The gelatinolytic bands migrating at 135 kD are likely to be complexes formed between gelatinase B and neutrophil gelatinase-associated lipocalin (NGAL) (>>47<<), and bands at >135 kD are probably aggregates of gelatinase B (48)." . _:b20228 . . _:b205711447 . _:b20226 . . _:b205711529 . . . . _:b205711474 . _:b205711524 . _:b20214 . . . _:b20213 "This marker was therefore useful for normalizing the levels of mRNA despite a 5\u201310-fold increase in cell number (55, >>56<<) and a corresponding increase in total RNA due to Schwann cell proliferation and macrophage influx." . _:b20217 . _:b20195 . . _:b205711440 . _:b205711552 . _:b205711509 . _:b20200 . _:b20251 "NGF-\u03B2 expression has been localized to Schwann cells and fibroblasts in sciatic nerve (>>76<<). Interestingly, we observed the induction of NGF-\u03B2 in parallel with a small increase in TNF-\u03B1. TNF-\u03B1 induces NGF-\u03B2 in fibroblasts (77) and may regulate levels of NGF-\u03B2 in a similar way in Schwann cells and endoneurial fibroblasts of" . . _:b20243 "Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, 25, 72, >>73<<). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-\u03B21 and TNF-\u03B1 during early and late phases." . _:b205711455 . _:b20186 "The gelatinase B probe was synthesized with RNA from 1-d postcrush nerve by RT-PCR using the conditions described previously (>>38<<), subcloned into pBluescript KS, and sequenced." . _:b20261 "Gelatinase B can degrade myelin basic protein (>>83<<). Increased proteolytic activity in both macrophages and Schwann cells may enhance myelin degradation during the degenerative phase, or may be required to free Schwann cells from their BM connections as they proliferate and reestablish" . _:b20262 "Proteases have also been implicated in the truncation and inactivation of p75 lowaffinity NGF receptor (>>85<<), and in the processing of TNF-\u03B1 precursor to its secreted form in vitro (86)." . _:b20224 . _:b205711549 . _:b20259 . . . _:b205711512 . _:b205711515 . _:b205711450 . _:b20239 . _:b205711494 . _:b20183 . _:b20239 "Interestingly, we and others (>>71<<) have observed that immunoreactive laminin and COL IV were maintained in vivo for up to 4 wk after axotomy and for 10 d after crush." . _:b205711462 . _:b20189 "Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (41); a 920-bp (position 709\u20131629) fragment of mouse TNF-\u03B1 cDNA (>>43<<); or a 294-bp (position 805\u2013 1099) fragment of mouse gelatinase B (44) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions (Boehringer Mannheim Corp., Indianapolis, IN)." . _:b205711545 . . . . _:b205711452 . . _:b20250 "mast cells which interact closely with innervating fibers in vivo and are known to release NGF-\u03B2 (61), may be responsible for the first increase in NGF-\u03B2 mRNA, whereas the second increase is mediated by macrophage-derived IL-1 (>>75<<). NGF-\u03B2 expression has been localized to Schwann cells and fibroblasts in sciatic nerve (76)." . _:b20181 . _:b205711467 . _:b20218 . _:b20177 . _:b20175 "To demonstrate metalloproteinase activity, the gel was incubated in substrate buffer with 50 \u03BCM 3-(Nhydroxycarbamoyl)-2(R)-isobutylpropionyl-l-tryptophan methylamide (GM6001) (>>28<<) (gift of R." . _:b205711489 . . _:b20180 . . . . . _:b20242 "Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, 25, >>72<<, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-\u03B21 and TNF-\u03B1 during early and late phases." . _:b20215 "ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (57, >>58<<), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (59), were used as markers for macrophages." . _:b205711553 . _:b20186 . . . . _:b205711476 . _:b205711451 . _:b20181 "Primers used in PCR reactions for apolipoprotein E (ApoE), CSF-1, glyceraldehyde-6-phosphate dehydrogenase (GAPDH), TNF-\u03B1, TGF-\u03B21, stromelysin-1, TIMP-1, IL-1\u03B1 and NGF-\u03B2 were described previously (>>33<<\u201335). The following oligonucleotides were synthesized on a PCR Mate (Applied Biosystems Inc., Foster City, CA) and used for PCR:" . _:b205711519 . _:b20190 "Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (41); a 920-bp (position 709\u20131629) fragment of mouse TNF-\u03B1 cDNA (43); or a 294-bp (position 805\u2013 1099) fragment of mouse gelatinase B (>>44<<) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions (Boehringer Mannheim Corp., Indianapolis, IN)." . _:b20172 . . _:b20214 "ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (>>57<<, 58), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (59), were used as markers for macrophages." . _:b20173 . _:b20174 . . _:b20192 . _:b20181 . . _:b20175 . _:b20168 . _:b205711442 . . _:b20169 . . _:b205711536 . . _:b20170 . _:b205711484 . _:b205711501 . . _:b20171 . . _:b20180 . . . . . _:b20181 . _:b20241 "Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (22, >>25<<, 72, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-\u03B21 and TNF-\u03B1 during early and late phases." . _:b20247 . _:b20182 . _:b20183 . . _:b20176 . . _:b205711521 . _:b20177 . _:b20178 . . . _:b20179 . _:b205711468 . _:b20197 "proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, >>18<<). MMPs, however, are the major contributors to ECM degradation. Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (6, 8)." . _:b20201 "In the crush and distal segments, gelatinolytic bands 92 and 72 kD shifted to lower molecular weight species of 85 and 66 kD, respectively, after APMA treatment, indicating latency (>>27<<). Because of partial activation by APMA treatment, other gelatinolytic bands generated represent intermediate forms of the proenzyme. Incubation of the zymogram with the synthetic MMP inhibitor GM6001 identified all the gelatinases as" . _:b20188 . . _:b20189 . . _:b20190 . _:b20234 "Schwann cells are the likely source of stromelysin-1 in nerve injury because they produce this MMP in vitro (>>49<<)." . . _:b20252 "TNF-\u03B1 induces NGF-\u03B2 in fibroblasts (>>77<<) and may regulate levels of NGF-\u03B2 in a similar way in Schwann cells and endoneurial fibroblasts of regenerating nerve." . _:b20191 . . . _:b20184 . . . _:b20185 . _:b20198 . . _:b20186 . _:b20206 . _:b20210 "After injury to nerve, Schwann cell BM remains intact and serves as a substrate to guide and stimulate axonal regrowth (>>4<<, 17). Because we observed an increase in both TIMP-1 and MMP activities in injured nerve, we concluded that TIMP-1 may regulate MMP activity in the nerve after injury." . _:b20187 . _:b205711523 . _:b205711456 . _:b205711457 . _:b20196 . _:b20197 . _:b20198 . _:b205711441 . _:b20199 . . _:b20192 . _:b205711510 . _:b20230 . _:b20193 . . _:b20194 . _:b205711453 . _:b20221 "Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-\u03B21, TNF-\u03B1, and IL-1\u03B1 (>>34<<), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, 63, 64)." . _:b20195 . _:b205711465 . . _:b20204 . _:b205711504 . _:b20224 "Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-\u03B21, TNF-\u03B1, and IL-1\u03B1 (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, 63, >>64<<). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium conditioned by" . _:b20205 . _:b20206 . _:b205711565 . . _:b20207 . _:b20200 . . _:b205711470 . _:b20168 "materials and methods" . _:b20201 . . . _:b20202 . _:b20263 . . _:b20240 . . _:b20203 . _:b20212 . _:b20213 . . _:b20214 . _:b20187 "For antibody staining, serial cryosections were rehydrated, blocked in 5% normal serum, and incubated for 1 h at 25\u00B0C with either macrophage-specific rat mAb F4/80 (>>42<<) (1:5; gift of S. Gordon, University of Oxford, Oxford, England) or polyclonal rabbit anti\u2013bovine antibody S-100 (1:2,000; Dako Corp., Carpenteria, CA). Biotinylated secondary antibody, the avidin-biotin-peroxidase complex, and the" . . _:b20225 . _:b205711503 . _:b20215 . . _:b20185 "The following random-primed cDNA probes were used: mouse TIMP-1 full-length cDNA (>>41<<) and a partiallength mouse gelatinase B." . . _:b20208 . _:b20209 . . _:b20210 . . _:b20211 . . _:b20220 . _:b205711502 . _:b20208 . _:b20221 . . _:b205711518 . _:b20249 . _:b20222 . _:b20245 . _:b20231 . _:b20208 "Small amounts of inhibitor migrating at 22 kD, which were present in CM from injured nerve but undetectable in CM from contralateral nerve, comigrated with TIMP-2 (>>26<<). The inhibitory band at 24 kD migrated like TIMP-3 (53)." . _:b20255 "Leibovich and Ross (>>79<<) demonstrated that ablation of macrophages impairs the progression of dermal wound healing." . _:b205711439 . _:b20223 . _:b205711490 . . _:b205711438 . _:b20216 . _:b20204 . _:b20173 . _:b205711438 . _:b20207 . _:b20217 . . _:b20218 . _:b20172 . _:b20244 . _:b20219 . . _:b20169 "Macrophage-conditioned medium from lipopolysaccharide-stimulated (10 \u03BCg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (>>23<<) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect:" . _:b205711445 . . _:b205711534 . _:b205711508 . _:b205711444 . . . _:b205711447 . _:b20180 "This assay was performed essentially as described previously (>>32<<). Briefly, to assess laminin and type IV collagen (COL IV) degradation in vitro, we placed 10-\u03BCm cryosections of uninjured sciatic nerve on sterile, precoated (0.1% gelatin) glass coverslips." . _:b205711446 . _:b205711472 . _:b205711441 . . _:b205711440 . _:b205711443 . . _:b205711442 . . . _:b205711453 . . . _:b205711452 . . _:b205711455 . . _:b205711454 . _:b20195 "The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, >>46<<), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18)." . _:b20232 "Both cell types are known to release gelatinase B after stimulation in vitro (48, >>67<<). Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (11). This result is borne out" . _:b205711449 . _:b205711448 . _:b205711451 . _:b20181 . . _:b205711450 . _:b205711560 . _:b205711461 . _:b20194 "The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, >>45<<, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18)." . . . . _:b205711460 . _:b20194 . _:b205711463 . _:b205711462 . _:b205711457 . _:b20212 . . . _:b205711456 . _:b20216 "ApoE, a protein involved in the recycling of lipids and produced by macrophages during nerve degeneration (57, 58), and c-fms, the CSF-1 receptor expressed constitutively in macrophages (>>59<<), were used as markers for macrophages." . _:b20228 "discussion" . _:b205711542 . . . _:b205711459 . _:b20235 "In keratoconus corneal injury (>>68<<) and in cutaneous burn wounds (69), proteinases are in excess of inhibitors, and net ECM degradation does occur." . _:b205711458 . . _:b205711544 . _:b205711469 . _:b20238 . _:b20179 . _:b20176 . . _:b20216 . _:b205711468 . _:b20178 . . _:b205711538 . _:b205711471 . _:b20188 "Sense and antisense digoxigenin-labeled cRNA transcripts from a 770-bp full-length mouse TIMP-1 cDNA (>>41<<); a 920-bp (position 709\u20131629) fragment of mouse TNF-\u03B1 cDNA (43); or a 294-bp (position 805\u2013 1099) fragment of mouse gelatinase B (44) were prepared by using the digoxigenin-RNA labeling kit according to the manufacturer's instructions" . . _:b205711470 . _:b20236 "In keratoconus corneal injury (68) and in cutaneous burn wounds (>>69<<), proteinases are in excess of inhibitors, and net ECM degradation does occur." . _:b205711465 . _:b205711464 . _:b20170 "lipopolysaccharide-stimulated (10 \u03BCg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-\u03B1 (>>24<<), TGF-\u03B21 (25), and IL-1\u03B1 (7). Organ cultures were incubated for 12 h at 37\u00B0C in an atmosphere of 5% CO2." . _:b205711559 . _:b20178 "Gelatin-degrading activity in nerve extracts was determined by using heat-denatured 14C-labeled collagen type I (boiled for 5 min; provided by M.J. Banda, University of California, San Francisco, CA) as a substrate (>>30<<). Various amounts of nerve extract or recombinant human TIMP-1 (0\u201330 ng) (gift of D. Carmichael, Synergen, Boulder, CO) were preincubated at 37\u00B0C for 1 h in the presence of 100 ng purified gelatinase B in a volume of 150 \u03BCl, and then 50" . . _:b205711537 . _:b205711467 . . _:b205711466 . _:b205711477 . _:b205711491 . _:b20241 . _:b20205 . _:b205711476 . . _:b205711528 . _:b205711479 . _:b20201 . . _:b205711478 . _:b205711514 . _:b20248 . _:b205711473 . _:b205711472 . . _:b20238 "Stromelysin-1, a proteinase that degrades the other BM components, fibronectin and proteoglycans (50, 54), was also upregulated after injury and is known to be inhibited by TIMP-1 in vivo and in vitro (>>70<<). Interestingly, we and others (71) have observed that immunoreactive laminin and COL IV were maintained in vivo for up to 4 wk after axotomy and for 10 d after crush. Our data indicate that one important role for TIMP-1 in vivo is the" . _:b20237 "Stromelysin-1, a proteinase that degrades the other BM components, fibronectin and proteoglycans (>>50<<, 54), was also upregulated after injury and is known to be inhibited by TIMP-1 in vivo and in vitro (70)." . _:b205711475 . _:b20250 . _:b205711471 . _:b20219 . _:b205711474 . . _:b20231 "Both cell types are known to release gelatinase B after stimulation in vitro (>>48<<, 67). Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (11). This result is borne" . . _:b20204 "With a sensitive enzymatic assay based on inhibition of 14C-labeled gelatin degradation by purified gelatinase B (>>30<<, 51), we found that extracts of injured nerve contained net MMP inhibitory activity (Fig." . _:b205711444 . _:b205711485 . _:b205711558 . _:b205711484 . _:b20253 . _:b205711550 . . _:b205711487 . _:b205711486 . _:b205711486 . _:b205711481 . _:b205711473 . . . . _:b20169 . . _:b205711480 . _:b205711438 "6"^^ . . _:b205711483 . _:b205711568 . _:b20254 . _:b20222 "Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-\u03B21, TNF-\u03B1, and IL-1\u03B1 (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (>>25<<, 63, 64). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium" . _:b205711439 "6"^^ . _:b20227 . . _:b205711482 . _:b20205 "With a sensitive enzymatic assay based on inhibition of 14C-labeled gelatin degradation by purified gelatinase B (30, >>51<<), we found that extracts of injured nerve contained net MMP inhibitory activity (Fig." . _:b20213 . _:b205711493 . . . . _:b205711492 . . . _:b205711495 . . _:b20200 "The gelatinolytic bands migrating at 135 kD are likely to be complexes formed between gelatinase B and neutrophil gelatinase-associated lipocalin (NGAL) (47), and bands at >135 kD are probably aggregates of gelatinase B (>>48<<)." . _:b205711494 . _:b20190 . _:b205711489 . . . _:b20218 "At day 1, before the influx of macrophages, mast cells may produce NGF-\u03B2 mRNA (>>61<<), whereas Schwann cells stimulated by macrophage-derived IL-1\u03B1 (7) may express NGF-\u03B2 at day 4." . _:b20228 _:b20260 . _:b205711488 . _:b20228 _:b20261 . . _:b20228 _:b20262 . _:b20228 _:b20263 . _:b20228 _:b20256 . _:b205711491 . _:b20228 _:b20257 . _:b205711445 "4"^^ . _:b20228 _:b20258 . _:b20228 _:b20259 . _:b205711477 . _:b20257 . _:b205711490 . _:b20257 "Schwann cells have been shown to initiate myelin degradation in vivo before the influx of macrophages, whereas infiltrating macrophages degrade the bulk of myelin during later stages of repair (>>80<<). Macrophages also produce an array of growth factors and cytokines after nerve injury. Up until now, our knowledge of the pleiotropic effects of these factors after nerve injury was limited. It is possible, based on results from in vitro" . _:b205711454 . _:b205711444 "5"^^ . . _:b20228 _:b20264 . _:b205711501 . _:b205711447 "4"^^ . . . . _:b20228 _:b20244 . _:b20254 "Interestingly, NGF-\u03B2 stimulates the transcription of stromelysin-1 mRNA in PC12 cells through a NGF-responsive element in the promoter region of the stromelysin-1 gene (>>78<<). A similar process may modulate stromelysin-1 expression during degeneration." . _:b205711500 . _:b20228 _:b20245 . _:b205711446 "4"^^ . _:b20249 "As may be the case for TNF-\u03B1, activated mast cells which interact closely with innervating fibers in vivo and are known to release NGF-\u03B2 (>>61<<), may be responsible for the first increase in NGF-\u03B2 mRNA, whereas the second increase is mediated by macrophage-derived IL-1 (75)." . _:b20193 "The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (>>20<<, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18)." . _:b205711533 . _:b20228 _:b20246 . _:b20228 _:b20247 . _:b205711539 . _:b20228 _:b20240 . _:b205711503 . _:b20228 _:b20241 . _:b20228 _:b20242 . _:b20228 _:b20243 . _:b20228 _:b20252 . _:b205711502 . _:b20228 _:b20253 . _:b20228 _:b20254 . _:b20244 "Although we did not identify which cells synthesized TGF-\u03B21 and TNF-\u03B1 in the early phase after injury, these cytokines may be produced by resident macrophages, Schwann cells, or mast cells in injured peripheral nerve (8, >>61<<, 74). In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, 59). This increase occurred within 1 d of crush injury, before the influx" . _:b20228 _:b20255 . _:b205711440 "6"^^ . _:b20228 _:b20248 . _:b205711497 . _:b20228 _:b20249 . _:b20228 _:b20250 . _:b205711443 "5"^^ . _:b20228 _:b20251 . _:b205711441 "6"^^ . _:b205711496 . _:b20228 _:b20229 . _:b205711460 . _:b20228 _:b20230 . _:b205711442 "5"^^ . _:b205711531 . _:b205711530 . _:b20228 _:b20231 . . _:b205711499 . _:b205711453 "4"^^ . . _:b20228 _:b20236 . _:b20251 . _:b205711498 . _:b20171 . _:b20228 _:b20237 . _:b205711452 "4"^^ . _:b20228 _:b20238 . . _:b20228 _:b20239 . _:b20191 _:b20224 . _:b20228 _:b20232 . _:b20191 _:b20225 . _:b205711455 "3"^^ . _:b20191 _:b20226 . _:b20228 _:b20233 . _:b205711509 . . _:b20191 _:b20227 . _:b20228 _:b20234 . _:b20228 _:b20235 . _:b20211 "After injury to nerve, Schwann cell BM remains intact and serves as a substrate to guide and stimulate axonal regrowth (4, >>17<<). Because we observed an increase in both TIMP-1 and MMP activities in injured nerve, we concluded that TIMP-1 may regulate MMP activity in the nerve after injury." . _:b205711454 "3"^^ . _:b20174 . . _:b205711508 . _:b20179 "The K i of TIMP-1 inhibition of gelatinase B activity in this assay, determined by titration of gelatinase B with various amounts of recombinant TIMP-1, was 0.1 nM, which corresponds to previous findings (>>30<<)." . _:b205711562 . _:b205711511 . _:b205711449 "4"^^ . . _:b205711510 . _:b205711448 "4"^^ . _:b205711507 . . _:b205711505 . _:b205711451 "4"^^ . _:b205711504 . _:b205711450 "4"^^ . _:b205711551 . _:b205711461 "3"^^ . _:b205711507 . . _:b20196 "proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (10) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (>>9<<, 18). MMPs, however, are the major contributors to ECM degradation. Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (6, 8)." . _:b205711541 . _:b20184 "Based on these values, the cDNA in each unlabeled RT mix was equalized by dilution in water. Semi-quantitative PCR was performed as described previously (>>40<<). Briefly, the cDNA was amplified in the thermocycler (Gene Amp PCR thermocycler; Perkin-Elmer Corp., Norwalk, CT) in a final volume of 30 \u03BCl containing 50 mM KCl, 10 mM Tris, pH 8.3, 4 mM MgCl2, 0.4 \u03BCM 5\u2032 and 3\u2032 primers, and 0.6 U of Taq" . _:b205711460 "3"^^ . _:b205711464 . _:b205711506 . _:b20189 . _:b205711463 "3"^^ . _:b205711517 . _:b205711480 . _:b20230 "ECM-degrading proteinases and their inhibitors play an active role in BM turnover during remodeling and repair after injury (21, >>22<<). Previous studies have shown the importance of proteinases and their inhibitors in the regenerative phase after nerve injury in vivo, but have not addressed how BM can be preserved in such a proteolytic environment and how it can support" . _:b205711462 "3"^^ . _:b205711516 . _:b205711457 "3"^^ . _:b205711519 . _:b205711456 "3"^^ . _:b205711518 . _:b205711505 . _:b20197 . _:b205711459 "3"^^ . _:b20222 . _:b205711540 . _:b205711513 . . _:b205711499 . _:b205711458 "3"^^ . _:b205711512 . . _:b205711527 . _:b20228 . . _:b205711469 "3"^^ . _:b205711515 . _:b205711498 . _:b20229 . _:b205711468 "3"^^ . _:b205711514 . . _:b20230 . _:b205711443 . _:b205711525 . _:b205711471 "3"^^ . . _:b20231 . _:b205711470 "3"^^ . _:b205711524 . _:b20224 . _:b205711522 . . _:b205711465 "3"^^ . _:b205711527 . _:b20225 . _:b20191 "results" . _:b205711475 . _:b205711464 "3"^^ . _:b205711526 . _:b20226 . _:b205711467 "3"^^ . _:b20264 . _:b205711521 . _:b205711446 . _:b20227 . _:b205711493 . _:b205711466 "3"^^ . _:b205711520 . _:b205711463 . _:b20236 . _:b205711477 "2"^^ . _:b20260 . _:b205711523 . _:b20182 . . _:b20237 . _:b205711476 "2"^^ . . . _:b205711522 . . . _:b20238 . _:b20225 "TGF-\u03B21 and TNF-\u03B1 were clearly autoinductive for their own mRNAs, in agreement with previous reports (>>65<<, 66). GAPDH mRNA was unaltered by these treatments. NGF-\u03B2 mRNA expression increased from three- to fivefold in the presence of TNF-\u03B1 and TGF-\u03B21 and up to 11-fold in the presence of IL-1\u03B1, thus confirming previous results (7). These data" . _:b205711479 "2"^^ . _:b205711533 . _:b20184 . _:b20239 . _:b205711478 "2"^^ . _:b205711532 . . _:b20232 . _:b205711473 "2"^^ . _:b205711535 . . _:b20233 . _:b205711472 "3"^^ . _:b205711534 . _:b20168 _:b20172 . _:b20234 . _:b20168 _:b20173 . _:b205711548 . _:b205711475 "2"^^ . _:b20168 _:b20174 . _:b205711529 . _:b205711500 . . _:b20168 _:b20175 . _:b20235 . _:b20168 _:b20169 . _:b20253 "In the distal segment, NGF-\u03B2 expression increased 4 d after injury, then fell markedly at the onset of regeneration at day 7, as shown previously (>>75<<). We observed upregulation of stromelysin-1 in parallel with the induction of NGF-\u03B2. Interestingly, NGF-\u03B2 stimulates the transcription of stromelysin-1 mRNA in PC12 cells through a NGF-responsive element in the promoter region of the" . _:b205711474 "2"^^ . _:b20168 _:b20170 . _:b205711528 . _:b20168 _:b20171 . _:b20168 _:b20180 . _:b20244 . _:b20168 _:b20181 . _:b20232 . _:b205711485 "2"^^ . _:b20168 _:b20182 . _:b20182 "were synthesized on a PCR Mate (Applied Biosystems Inc., Foster City, CA) and used for PCR: c-fms (36) 5\u2032-primer: AAGAACATATACAGCATCATGCAG (bp 2713\u20132737), 3\u2032-primer: CGATGTCCCCTGGCTCACAGCA (bp 2945\u20132966); p75 low-affinity NGF receptor (>>37<<) 5\u2032-primer: CAGAGCCTGCACGACCAGCAGACCCA (bp 1050\u20131075), 3\u2032-primer: GGCCAGCAGGGCTCGCACTGGGCA (bp 1247\u20131269); gelatinase B (38) 5\u2032-primer:" . _:b205711531 . _:b20168 _:b20183 . _:b20168 _:b20176 . _:b20245 . _:b20168 _:b20177 . _:b205711484 "2"^^ . _:b20168 _:b20178 . _:b205711530 . _:b20168 _:b20179 . _:b20168 _:b20188 . _:b20246 . _:b20168 _:b20189 . _:b20256 "In peripheral nerves, regeneration and degeneration do not occur without an influx of inflammatory macrophages (>>6<<). During Wallerian degeneration, macrophages play a key role in myelin removal in the later phases of repair. Schwann cells have been shown to initiate myelin degradation in vivo before the influx of macrophages, whereas infiltrating" . _:b205711487 "2"^^ . _:b20168 _:b20190 . _:b20193 . _:b205711541 . . _:b20168 _:b20184 . _:b20247 . _:b20168 _:b20185 . _:b205711486 "2"^^ . _:b20168 _:b20186 . _:b205711540 . . _:b20168 _:b20187 . _:b20240 . _:b205711481 "2"^^ . _:b205711566 . . _:b205711543 . _:b20171 "(10 \u03BCg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-\u03B1 (24), TGF-\u03B21 (>>25<<), and IL-1\u03B1 (7). Organ cultures were incubated for 12 h at 37\u00B0C in an atmosphere of 5% CO2." . . _:b20241 . _:b205711480 "2"^^ . . _:b205711542 . _:b20242 . . _:b205711483 "2"^^ . _:b205711537 . _:b20243 . . _:b205711482 "2"^^ . _:b205711536 . _:b20183 "(bp 2713\u20132737), 3\u2032-primer: CGATGTCCCCTGGCTCACAGCA (bp 2945\u20132966); p75 low-affinity NGF receptor (37) 5\u2032-primer: CAGAGCCTGCACGACCAGCAGACCCA (bp 1050\u20131075), 3\u2032-primer: GGCCAGCAGGGCTCGCACTGGGCA (bp 1247\u20131269); gelatinase B (>>38<<) 5\u2032-primer: CGCTCATGTACCCGCTGTATAGCTAC (bp 1277\u20131302), 3\u2032-primer: TAGAGGCCTCAGAAGAGCCCGCA (bp 1575\u20131597)." . _:b20252 . _:b205711493 "2"^^ . _:b205711567 . _:b205711513 . _:b20219 "At day 1, before the influx of macrophages, mast cells may produce NGF-\u03B2 mRNA (61), whereas Schwann cells stimulated by macrophage-derived IL-1\u03B1 (>>7<<) may express NGF-\u03B2 at day 4." . _:b205711539 . _:b20223 "Upon stimulation, macrophages produce many cytokines and growth factors, including TGF-\u03B21, TNF-\u03B1, and IL-1\u03B1 (34), all of which have been known to induce TIMP-1 expression in fibroblasts in culture (25, >>63<<, 64). To determine whether macrophage-derived growth factors regulate expression of TIMP-1 during tissue remodeling, we cultured explants of uninjured nerve (which does not contain infiltrating macrophages) for 12 h with medium" . _:b20253 . _:b205711492 "2"^^ . _:b205711538 . _:b20254 . . _:b205711495 "2"^^ . . _:b205711549 . . _:b20255 . _:b205711494 "2"^^ . . _:b205711548 . . _:b20248 . _:b205711489 "2"^^ . . . _:b205711551 . _:b20249 . _:b20261 . _:b205711488 "2"^^ . _:b205711550 . . _:b20250 . _:b20198 "Therefore, we examined MMP activity in extracts of injured sciatic nerve after 1 d and 4 d, when neutrophil and macrophage recruitment into wound sites is maximal (>>6<<, 8). Tissue extracts from sham-operated nerve, contralateral nerve, and the proximal-crush-distal segments of injured nerve showed gelatinolytic bands migrating at 92, 85, 72, and 66 kD, corresponding to progelatinase B, active gelatinase" . _:b205711491 "2"^^ . _:b205711545 . _:b20251 . _:b205711490 "2"^^ . . . _:b205711544 . _:b20209 "Small amounts of inhibitor migrating at 22 kD, which were present in CM from injured nerve but undetectable in CM from contralateral nerve, comigrated with TIMP-2 (26). The inhibitory band at 24 kD migrated like TIMP-3 (>>53<<)." . _:b20260 . _:b205711501 "2"^^ . _:b205711485 . . _:b205711547 . . _:b20261 . _:b205711500 "2"^^ . _:b20202 . . _:b205711546 . _:b20258 "It is possible, based on results from in vitro experiments, that TGF-\u03B21 may trigger Schwann proliferation in vivo (>>81<<), whereas TNF-\u03B1 may regulate levels of IL-1 (82) which in turn may stimulate the induction of NGF-\u03B2 in Schwann cells (7)." . _:b20262 . _:b205711503 "2"^^ . _:b20263 "Proteases have also been implicated in the truncation and inactivation of p75 lowaffinity NGF receptor (85), and in the processing of TNF-\u03B1 precursor to its secreted form in vitro (>>86<<). Additionally, a Schwann cell\u2013derived proteinase, possibly stromelysin-1, cleaves fibronectin to generate a proteolytic fragment with anti-proliferative activity on Schwann cells in culture (49). It is clear from these findings that MMP" . _:b20203 . _:b205711557 . _:b205711520 . _:b20263 . _:b205711502 "2"^^ . _:b205711556 . _:b20237 . . _:b20256 . _:b20191 _:b20216 . _:b20191 _:b20217 . _:b20259 "It is possible, based on results from in vitro experiments, that TGF-\u03B21 may trigger Schwann proliferation in vivo (81), whereas TNF-\u03B1 may regulate levels of IL-1 (>>82<<) which in turn may stimulate the induction of NGF-\u03B2 in Schwann cells (7)." . _:b205711497 "2"^^ . _:b20191 _:b20218 . _:b205711559 . _:b20191 _:b20219 . _:b20191 _:b20220 . _:b20257 . . _:b20188 . _:b205711496 "2"^^ . _:b20191 _:b20221 . _:b20191 _:b20222 . _:b205711558 . _:b20191 _:b20223 . _:b20233 . _:b205711482 . _:b20258 . _:b20246 "In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (>>6<<, 59). This increase occurred within 1 d of crush injury, before the influx of inflammatory macrophages. That TNF-\u03B1 and TGF-\u03B21 may initiate and regulate TIMP-1 expression during the early and late phases of nerve regeneration is supported" . _:b20191 _:b20208 . _:b20191 _:b20209 . _:b205711499 "2"^^ . _:b205711496 . _:b20191 _:b20210 . _:b205711553 . _:b20191 _:b20211 . _:b20262 . _:b20212 "This marker was therefore useful for normalizing the levels of mRNA despite a 5\u201310-fold increase in cell number (>>55<<, 56) and a corresponding increase in total RNA due to Schwann cell proliferation and macrophage influx." . _:b20191 _:b20212 . _:b20259 . _:b20191 _:b20213 . _:b205711498 "2"^^ . _:b20191 _:b20214 . _:b205711552 . _:b20191 _:b20215 . _:b20191 _:b20200 . _:b20211 . _:b20191 _:b20201 . _:b20185 . _:b205711509 "2"^^ . _:b20191 _:b20202 . _:b20234 . _:b205711555 . . . _:b20191 _:b20203 . _:b20191 _:b20204 . . . _:b20191 _:b20205 . _:b205711508 "2"^^ . _:b20191 _:b20206 . _:b205711554 . _:b20191 _:b20207 . _:b20191 _:b20192 . _:b20191 _:b20193 . _:b205711511 "2"^^ . _:b20191 _:b20194 . _:b205711565 . _:b20191 _:b20195 . _:b20191 _:b20196 . _:b20191 _:b20197 . _:b205711510 "2"^^ . _:b20191 _:b20198 . _:b205711564 . _:b20191 _:b20199 . _:b20264 . _:b205711505 "2"^^ . _:b205711567 . . _:b20210 . _:b205711504 "2"^^ . _:b205711566 . _:b205711507 "2"^^ . _:b205711516 . _:b20206 "activity present in 4-d postcrush nerve extracts was equivalent to 2 ng recombinant TIMP-1/5 \u03BCg extractable protein and was comparable to the inhibitory activity found in extracts of calvaria, which has high levels of TIMP-1 activity (>>52<<). No inhibitory activity was found in extracts of contralateral nerve." . _:b205711561 . _:b205711506 "2"^^ . _:b205711560 . _:b205711517 "2"^^ . _:b205711563 . _:b205711516 "2"^^ . _:b205711562 . . . _:b205711519 "2"^^ . . _:b205711546 . . _:b20229 . _:b205711518 "2"^^ . _:b205711513 "2"^^ . . _:b205711512 "2"^^ . . _:b205711532 . . _:b205711515 "2"^^ . _:b205711511 . _:b205711569 . _:b20260 "It is possible, based on results from in vitro experiments, that TGF-\u03B21 may trigger Schwann proliferation in vivo (81), whereas TNF-\u03B1 may regulate levels of IL-1 (82) which in turn may stimulate the induction of NGF-\u03B2 in Schwann cells (>>7<<). Our results show that these macrophage-derived cytokines not only regulate cytokine and growth factor mRNA expression in nerve, but also may regulate TIMP-1 and MMP expression." . . _:b205711556 . _:b205711514 "2"^^ . _:b205711568 . _:b205711488 . _:b205711525 "2"^^ . _:b20217 "The expression of mRNA for NGF-\u03B2, a trophic factor critical for neuronal survival and growth (>>60<<), was upregulated after injury (Fig." . _:b205711569 . _:b205711524 "2"^^ . _:b20187 . _:b20170 . _:b20242 . _:b205711527 "2"^^ . _:b20235 . _:b20203 "A small amount of active stromelysin-1 migrating at 45 kD was visualized in concentrated CM from crush and distal segments, but not with contralateral nerve. The lower band at 35 kD is another cleavage product of stromelysin-1 (>>50<<)." . _:b20229 "ECM-degrading proteinases and their inhibitors play an active role in BM turnover during remodeling and repair after injury (>>21<<, 22). Previous studies have shown the importance of proteinases and their inhibitors in the regenerative phase after nerve injury in vivo, but have not addressed how BM can be preserved in such a proteolytic environment and how it can" . _:b205711526 "2"^^ . _:b205711521 "2"^^ . _:b205711520 "2"^^ . "PMC0" . _:b20172 "(10 \u03BCg/ml, 24 h in serum-free DMEM) mouse peritoneal exudate macrophages (23) or various recombinant growth factors were added at concentrations comparable to those known to produce a maximal effect: TNF-\u03B1 (24), TGF-\u03B21 (25), and IL-1\u03B1 (>>7<<). Organ cultures were incubated for 12 h at 37\u00B0C in an atmosphere of 5% CO2." . _:b205711523 "2"^^ . _:b205711568 . _:b205711522 "2"^^ . . _:b205711569 . . _:b20258 . _:b205711466 . _:b205711533 "2"^^ . . _:b20174 "Louis, MO) for 1 h to partially activate MMPs, as described previously (>>27<<). Briefly, samples were solubilized in nonreducing Laemmli buffer without heating and separated on nonreducing 10% SDS\u2013 polyacrylamide gels containing 0.1% gelatin." . _:b205711532 "2"^^ . _:b20247 "In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, >>59<<). This increase occurred within 1 d of crush injury, before the influx of inflammatory macrophages. That TNF-\u03B1 and TGF-\u03B21 may initiate and regulate TIMP-1 expression during the early and late phases of nerve regeneration is supported by" . _:b205711526 . _:b205711535 "2"^^ . . _:b20243 . _:b205711543 . _:b205711552 . _:b205711534 "2"^^ . _:b205711553 . _:b205711506 . _:b205711547 . _:b205711554 . _:b205711555 . _:b205711556 . _:b205711529 "2"^^ . _:b205711557 . _:b205711558 . _:b205711559 . _:b205711560 . _:b205711528 "2"^^ . _:b205711561 . _:b205711562 . _:b20215 . _:b20199 . _:b205711563 . _:b205711564 . _:b205711531 "2"^^ . . _:b205711565 . _:b205711566 . _:b205711567 . _:b205711536 . _:b205711530 "2"^^ . _:b205711537 . _:b205711538 . _:b205711539 . _:b20245 "Although we did not identify which cells synthesized TGF-\u03B21 and TNF-\u03B1 in the early phase after injury, these cytokines may be produced by resident macrophages, Schwann cells, or mast cells in injured peripheral nerve (8, 61, >>74<<). In support of a role for resident macrophages, we observed an increase in c-fms, a specific macrophage marker that is upregulated in activated macrophages (6, 59). This increase occurred within 1 d of crush injury, before the influx of" . _:b205711540 . _:b205711541 "2"^^ . . _:b205711541 . _:b205711542 . _:b205711543 . . _:b205711540 "2"^^ . _:b205711544 . _:b205711545 . _:b20202 "To determine whether stromelysin-1, which has been found in cultures of NGFstimulated PC12 cells and mitogen-stimulated Schwann cells (>>49<<), was present in crushed nerve, we analyzed samples of medium conditioned by segments of crushed or contralateral nerve by immunoblotting (Fig." . _:b205711546 . . _:b205711547 . _:b205711548 . _:b205711543 "2"^^ . _:b205711549 . _:b205711550 . _:b205711551 . _:b205711520 . _:b205711542 "2"^^ . _:b205711521 . _:b205711445 . . _:b205711522 . _:b205711448 . _:b205711523 . _:b205711524 . _:b205711537 "2"^^ . _:b205711525 . _:b205711526 . _:b205711527 . _:b205711528 . _:b205711536 "2"^^ . _:b205711529 . _:b205711530 . _:b205711531 . _:b20223 . _:b205711532 . _:b20192 "The serine proteinases urokinase and tissue-type plasminogen activator are expressed during axonal growth (>>10<<) and regeneration in vivo (20, 45, 46), and a calcium-dependent proteinase is released by sympathetic and sensory neurons in culture (9, 18)." . _:b205711539 "2"^^ . _:b205711533 . _:b205711534 . _:b205711535 . _:b205711504 . _:b205711538 "2"^^ . _:b205711505 . _:b205711506 . _:b205711507 . _:b205711508 . _:b205711549 "2"^^ . _:b205711509 . _:b205711510 . . _:b205711511 . _:b205711512 . _:b205711548 "2"^^ . _:b205711513 . _:b205711514 . _:b205711515 . _:b205711516 . _:b205711551 "2"^^ . _:b205711517 . _:b205711518 . . _:b205711519 . _:b205711488 . _:b205711550 "2"^^ . _:b205711481 . _:b205711489 . _:b205711490 . _:b205711491 . _:b205711492 . _:b205711545 "2"^^ . _:b205711493 . _:b205711494 . _:b20177 "Purified gelatinase B was prepared from the mouse macrophage cell line P388D1 and activated with APMA before use as described previously (>>29<<). Gelatin-degrading activity in nerve extracts was determined by using heat-denatured 14C-labeled collagen type I (boiled for 5 min; provided by M.J. Banda, University of California, San Francisco, CA) as a substrate (30). Various amounts" . _:b205711495 . _:b205711496 . _:b205711544 "2"^^ . _:b205711497 . _:b205711497 . _:b205711498 . . _:b205711499 . _:b205711500 . _:b205711547 "2"^^ . _:b205711501 . _:b205711502 . _:b20252 . _:b205711503 . _:b205711472 . _:b205711546 "2"^^ . _:b205711473 . _:b205711474 . _:b205711475 . _:b205711476 . _:b205711557 "2"^^ . _:b205711477 . _:b20233 "Previous studies also showed increased MMP activity migrating at 92 kD in rat Schwann cell cultures at 4 d after denervation, suggesting that denervated Schwann cells are a potential source of gelatinase B (>>11<<). This result is borne out by our in situ hybridization analysis showing increased gelatinase B mRNA expression in both macrophages and Schwann cells in the crush and distal segments of sciatic nerve at 4 d after crush, before axonal" . _:b205711478 . _:b205711479 . _:b205711469 . _:b205711556 "2"^^ . _:b205711480 . _:b205711481 . _:b205711482 . _:b205711483 . _:b205711449 . _:b205711559 "2"^^ . _:b205711484 . _:b205711485 . _:b20264 "Additionally, a Schwann cell\u2013derived proteinase, possibly stromelysin-1, cleaves fibronectin to generate a proteolytic fragment with anti-proliferative activity on Schwann cells in culture (>>49<<). It is clear from these findings that MMP activities are not limited to BM and myelin degradation and may be involved in many other processes." . _:b205711486 . _:b205711479 . _:b205711554 . _:b205711478 . _:b205711487 . . _:b205711525 . _:b205711456 . _:b205711558 "2"^^ . _:b205711457 . _:b205711517 . _:b20220 "F4/80 positive cells were numerous in the crush segment, some displaying a rounded morphology and others arranged in strings of rounded cells called foamy macrophages (>>62<<). These may represent either infiltrating or resident macrophages. In the distal segment, macrophages were mostly rounded or ramified, whereas the few resident macrophages present in the proximal segment had extensive ramified cytoplasmic" . _:b205711458 . _:b205711461 . _:b205711459 . _:b205711460 . _:b205711553 "2"^^ . _:b205711461 . _:b205711462 . _:b205711463 . _:b205711464 . _:b205711552 "2"^^ . _:b205711465 . _:b205711466 . . _:b205711467 . _:b205711468 . _:b20175 . _:b205711555 "2"^^ . _:b205711469 . . _:b205711470 . _:b205711471 . _:b205711440 . _:b20220 . _:b205711554 "2"^^ . _:b205711441 . _:b205711442 . _:b205711443 . _:b205711444 . _:b205711565 "2"^^ . . _:b205711445 . _:b205711446 . . _:b205711447 . . _:b205711487 . _:b205711448 . _:b205711564 "2"^^ . _:b205711449 . _:b205711450 . _:b205711451 . _:b205711452 . _:b205711567 "2"^^ . _:b205711453 . _:b205711454 . _:b205711455 . _:b205711566 "2"^^ . _:b205711561 "2"^^ . _:b205711560 "2"^^ . . . _:b205711563 "2"^^ . _:b20246 . _:b205711438 . _:b205711439 . _:b205711495 . _:b205711562 "2"^^ . _:b205711561 . . . . . _:b20248 "NGF-\u03B2 mRNA also displays a biphasic induction in the crush and distal segments after injury (>>75<<). As may be the case for TNF-\u03B1, activated mast cells which interact closely with innervating fibers in vivo and are known to release NGF-\u03B2 (61), may be responsible for the first increase in NGF-\u03B2 mRNA, whereas the second increase is" . _:b205711459 . _:b20168 . . _:b205711555 . _:b205711563 . _:b205711569 "2"^^ . _:b20255 . . _:b20227 "NGF-\u03B2 mRNA expression increased from three- to fivefold in the presence of TNF-\u03B1 and TGF-\u03B21 and up to 11-fold in the presence of IL-1\u03B1, thus confirming previous results (>>7<<). These data suggest a macrophage/cytokine regulatory circuit that could be responsible for controlling TIMP-1 gene expression and thus BM remodeling in peripheral nerve after injury." . _:b20240 "Both MMPs and TIMPs have been shown to be transcriptionally regulated by growth factors, tumor promoters, and stress stimuli (>>22<<, 25, 72, 73). After nerve injury, the expression of gelatinase B and TIMP-1 paralleled the induction of the cytokines TGF-\u03B21 and TNF-\u03B1 during early and late phases." . _:b205711568 "2"^^ . . _:b20236 . _:b205711535 . _:b20176 "Reverse zymography of TIMPs was carried out as described previously (>>26<<). Briefly, concentrated CM (equivalent to 250 \u03BCl for nerve samples and 300 \u03BCl for the calvaria control) was separated on nonreducing 13.5% SDS\u2013polyacrylamide gels containing 0.1% gelatin and 25% (vol/vol) APMA-activated rabbit skin CM." . _:b20221 . . _:b20173 "Nerve extracts were analyzed by gelatin zymography (>>26<<). Some samples were treated with 1 mM 4-aminophenylmercuric acetate (APMA) (Sigma Chemical Co., St." . _:b205711564 . _:b20209 . _:b20191 . _:b20196 . . . . . _:b205711557 . . _:b20256 . . _:b205711439 . _:b205711492 . _:b20207 "The major inhibitory band at 28 kD secreted by the crushed nerve segments comigrated with TIMP-1 (>>30<<) from the mouse calvarial CM standard and was increased as compared with contralateral nerve." . _:b205711458 . _:b20226 "TGF-\u03B21 and TNF-\u03B1 were clearly autoinductive for their own mRNAs, in agreement with previous reports (65, >>66<<). GAPDH mRNA was unaltered by these treatments. NGF-\u03B2 mRNA expression increased from three- to fivefold in the presence of TNF-\u03B1 and TGF-\u03B21 and up to 11-fold in the presence of IL-1\u03B1, thus confirming previous results (7). These data" . _:b205711483 .